The Vital Question

The Vital Question Author Nick Lane
ISBN-10 9781847658807
Year 2015-04-23
Pages 569
Language en
Publisher Profile Books
DOWNLOAD NOW READ ONLINE

Why is life the way it is? Bacteria evolved into complex life just once in four billion years of life on earth-and all complex life shares many strange properties, from sex to ageing and death. If life evolved on other planets, would it be the same or completely different? In The Vital Question, Nick Lane radically reframes evolutionary history, putting forward a cogent solution to conundrums that have troubled scientists for decades. The answer, he argues, lies in energy: how all life on Earth lives off a voltage with the strength of a bolt of lightning. In unravelling these scientific enigmas, making sense of life's quirks, Lane's explanation provides a solution to life's vital questions: why are we as we are, and why are we here at all? This is ground-breaking science in an accessible form, in the tradition of Charles Darwin's The Origin of Species, Richard Dawkins' The Selfish Gene, and Jared Diamond's Guns, Germs and Steel.

The Vital Question

The Vital Question Author Nick Lane
ISBN-10 1781250375
Year 2016-04-07
Pages 352
Language en
Publisher
DOWNLOAD NOW READ ONLINE

Why is life the way it is? Bacteria evolved into complex life just once in four billion years of life on earth-and all complex life shares many strange properties, from sex to ageing and death. If life evolved on other planets, would it be the same or completely different?In The Vital Question, Nick Lane radically reframes evolutionary history, putting forward a cogent solution to conundrums that have troubled scientists for decades. The answer, he argues, lies in energy: how all life on Earth lives off a voltage with the strength of a bolt of lightning. In unravelling these scientific enigmas, making sense of life's quirks, Lane's explanation provides a solution to life's vital questions: why are we as we are, and why are we here at all?This is ground-breaking science in an accessible form, in the tradition of Charles Darwin's The Origin of Species, Richard Dawkins' The Selfish Gene, and Jared Diamond's Guns, Germs and Steel.

The Vital Question

The Vital Question Author Nick Lane
ISBN-10 1781250367
Year 2015-04-23
Pages 352
Language en
Publisher
DOWNLOAD NOW READ ONLINE

Why is life the way it is? Bacteria evolved into complex life just once in four billion years of life on earth - and all complex life shares many strange properties, from sex to ageing and death. If life evolved on other planets, would it be the same or completely different?In The Vital Question, Nick Lane radically reframes evolutionary history, putting forward a cogent solution to conundrums that have troubled scientists for decades. The answer, he argues, lies in energy: how all life on Earth lives off a voltage with the strength of a bolt of lightning. In unravelling these scientific enigmas, making sense of life's quirks, Lane's explanation provides a solution to life's vital questions: why are we as we are, and why are we here at all? This is ground-breaking science in an accessible form, in the tradition of Charles Darwin's The Origin of Species, Richard Dawkins' The Selfish Gene, and Jared Diamond's Guns, Germs and Steel.

The Vital Question Energy Evolution and the Origins of Complex Life

The Vital Question  Energy  Evolution  and the Origins of Complex Life Author Nick Lane
ISBN-10 9780393248197
Year 2015-07-20
Pages 352
Language en
Publisher W. W. Norton & Company
DOWNLOAD NOW READ ONLINE

“One of the deepest, most illuminating books about the history of life to have been published in recent years.” —The Economist The Earth teems with life: in its oceans, forests, skies and cities. Yet there’s a black hole at the heart of biology. We do not know why complex life is the way it is, or, for that matter, how life first began. In The Vital Question, award-winning author and biochemist Nick Lane radically reframes evolutionary history, putting forward a solution to conundrums that have puzzled generations of scientists. For two and a half billion years, from the very origins of life, single-celled organisms such as bacteria evolved without changing their basic form. Then, on just one occasion in four billion years, they made the jump to complexity. All complex life, from mushrooms to man, shares puzzling features, such as sex, which are unknown in bacteria. How and why did this radical transformation happen? The answer, Lane argues, lies in energy: all life on Earth lives off a voltage with the strength of a lightning bolt. Building on the pillars of evolutionary theory, Lane’s hypothesis draws on cutting-edge research into the link between energy and cell biology, in order to deliver a compelling account of evolution from the very origins of life to the emergence of multicellular organisms, while offering deep insights into our own lives and deaths. Both rigorous and enchanting, The Vital Question provides a solution to life’s vital question: why are we as we are, and indeed, why are we here at all?

Life Ascending

Life Ascending Author Nick Lane
ISBN-10 9781847652225
Year 2010-10-01
Pages 469
Language en
Publisher Profile Books
DOWNLOAD NOW READ ONLINE

Winner of the 2010 Royal Society Prize for science books Powerful new research methods are providing fresh and vivid insights into the makeup of life. Comparing gene sequences, examining the atomic structure of proteins and looking into the geochemistry of rocks have all helped to explain creation and evolution in more detail than ever before. Nick Lane uses the full extent of this new knowledge to describe the ten greatest inventions of life, based on their historical impact, role in living organisms today and relevance to current controversies. DNA, sex, sight and consciousnesses are just four examples. Lane also explains how these findings have come about, and the extent to which they can be relied upon. The result is a gripping and lucid account of the ingenuity of nature, and a book which is essential reading for anyone who has ever questioned the science behind the glories of everyday life.

Oxygen

Oxygen Author Nick Lane
ISBN-10 0198607830
Year 2002
Pages 374
Language en
Publisher Oxford University Press, USA
DOWNLOAD NOW READ ONLINE

Oxygen takes the reader on an enthralling journey, as gripping as a thriller, as it unravels the unexpected ways in which oxygen spurred the evolution of life and death. The book explains far more than the size of ancient insects: it shows how oxygen underpins the origin of biological complexity, the birth of photosynthesis, the sudden evolution of animals, the need for two sexes, the accelerated ageing of cloned animals like Dolly the sheep, and the surprisingly long lives of bats and birds. Drawing on this grand evolutionary canvas, Oxygen offers fresh perspectives on our own lives and deaths, explaining modern killer diseases, why we age, and what we can do about it.

Power Sex Suicide

Power  Sex  Suicide Author Nick Lane
ISBN-10 9780191622595
Year 2006-10-26
Pages 368
Language en
Publisher OUP Oxford
DOWNLOAD NOW READ ONLINE

Mitochondria are tiny structures located inside our cells that carry out the essential task of producing energy for the cell. They are found in all complex living things, and in that sense, they are fundamental for driving complex life on the planet. But there is much more to them than that. Mitochondria have their own DNA, with their own small collection of genes, separate from those in the cell nucleus. It is thought that they were once bacteria living independent lives. Their enslavement within the larger cell was a turning point in the evolution of life, enabling the development of complex organisms and, closely related, the origin of two sexes. Unlike the DNA in the nucleus, mitochondrial DNA is passed down exclusively (or almost exclusively) via the female line. That's why it has been used by some researchers to trace human ancestry daughter-to-mother, to 'Mitochondrial Eve'. Mitochondria give us important information about our evolutionary history. And that's not all. Mitochondrial genes mutate much faster than those in the nucleus because of the free radicals produced in their energy-generating role. This high mutation rate lies behind our ageing and certain congenital diseases. The latest research suggests that mitochondria play a key role in degenerative diseases such as cancer, through their involvement in precipitating cell suicide. Mitochondria, then, are pivotal in power, sex, and suicide. In this fascinating and thought-provoking book, Nick Lane brings together the latest research findings in this exciting field to show how our growing understanding of mitochondria is shedding light on how complex life evolved, why sex arose (why don't we just bud?), and why we age and die. This understanding is of fundamental importance, both in understanding how we and all other complex life came to be, but also in order to be able to control our own illnesses, and delay our degeneration and death. 'An extraordinary account of groundbreaking modern science... The book abounds with interesting and important ideas.' Mark Ridley, Department of Zoology, University of Oxford

Genesis

Genesis Author Robert Hazen
ISBN-10 9780309103107
Year 2005-09-09
Pages 368
Language en
Publisher National Academies Press
DOWNLOAD NOW READ ONLINE

Life on Earth arose nearly 4 billion years ago, bursting forth from air, water, and rock. Though the process obeyed all the rules of chemistry and physics, the details of that original event pose as deep a mystery as any facing science. How did non-living chemicals become alive? While the question is (deceivingly) simple, the answers are unquestionably complex. Science inevitably plays a key role in any discussion of life's origins, dealing less with the question of why life appeared on Earth than with where, when, and how it emerged on the blasted, barren face of our primitive planet. Astrobiologist Robert Hazen has spent many years dealing with the fundamental questions of life's genesis. As an active research scientist, he is down deep in all the messy details that science has to offer on the subject, tracing the inexorable sequence of events that led to the complicated interactions of carbonbased molecules. As he takes us through the astounding process of emergence, we are witness to the first tentative steps toward life-from the unfathomable abundance of carbon biomolecules synthesized in the black vacuum of space to the surface of the Earth to deep within our planet's restless crust. We are privy to the breathtaking drama that rapidly unfolds as life prevails. The theory of emergence is poised to answer a multitude of questions-even as it raises the possibility that natural processes exist beyond what we now know, perhaps beyond what we even comprehend. Genesis tells the tale of transforming scientific advances in our quest for life's origins. Written with grace, beauty, and authority, it goes directly to the heart of who we are and why we are here.

What is Life

What is Life Author Addy Pross
ISBN-10 9780191650895
Year 2012-09-27
Pages 224
Language en
Publisher OUP Oxford
DOWNLOAD NOW READ ONLINE

Seventy years ago, Erwin Schrödinger posed a profound question: 'What is life, and how did it emerge from non-life?' This problem has puzzled biologists and physical scientists ever since. Living things are hugely complex and have unique properties, such as self-maintenance and apparently purposeful behaviour which we do not see in inert matter. So how does chemistry give rise to biology? What could have led the first replicating molecules up such a path? Now, developments in the emerging field of 'systems chemistry' are unlocking the problem. Addy Pross shows how the different kind of stability that operates among replicating molecules results in a tendency for chemical systems to become more complex and acquire the properties of life. Strikingly, he demonstrates that Darwinian evolution is the biological expression of a deeper, well-defined chemical concept: the whole story from replicating molecules to complex life is one continuous process governed by an underlying physical principle. The gulf between biology and the physical sciences is finally becoming bridged. This new edition includes an Epilogue describing developments in the concepts of fundamental forms of stability discussed in the book, and their profound implications. Oxford Landmark Science books are 'must-read' classics of modern science writing which have crystallized big ideas, and shaped the way we think.

A New History of Life

A New History of Life Author Peter Ward
ISBN-10 9781408842805
Year 2015-04-14
Pages 400
Language en
Publisher Bloomsbury Publishing
DOWNLOAD NOW READ ONLINE

An estimated 4.6 billion years ago, the Earth and Moon were formed in a violent impact. On this, many agree, and even more that a long time after that, life began. However, few know that the first life on the Earth may not have emerged on this planet, but could, in fact, have begun on Mars, brought here by meteorites. In this revolutionary book, leading scientists Peter Ward and Joe Kirschvink rewrite the principal account of the history of life on Earth. They show not only how the rise of animals was delayed for billions of years, but also what it was that first forced fish out of the sea and onto the land. Together, the two scientists explain how developments in the environment led to multiple Ice Ages before the emergence of dinosaurs and other giant animals, and what the true cause of these great beasts' eventual extinction was. Finally, charting the course of our own evolution, they explore whether this generation will see the end of the human species. A New History of Life proves not only that much of what we think we know should be unlearned, but also that the true history of life on Earth is much more surprising and wonderful than we could ever have imagined.

The Power to Compete

The Power to Compete Author Hiroshi Mikitani
ISBN-10 9781119000600
Year 2014-11-10
Pages 240
Language en
Publisher John Wiley & Sons
DOWNLOAD NOW READ ONLINE

"If you're as interested in Japan as I am, I think you'll find that The Power to Compete is a smart and thought-provoking look at the future of a fascinating country." - Bill Gates, "5 Books to Read This Summer" Father and son – entrepreneur and economist – search for Japan's economic cure The Power to Compete tackles the issues central to the prosperity of Japan – and the world – in search of a cure for the "Japan Disease." As founder and CEO of Rakuten, one of the world's largest Internet companies, author Hiroshi Mikitani brings an entrepreneur's perspective to bear on the country's economic stagnation. Through a freewheeling and candid conversation with his economist father, Ryoichi Mikitani, the two examine the issues facing Japan, and explore possible roadmaps to revitalization. How can Japan overhaul its economy, education system, immigration, public infrastructure, and hold its own with China? Their ideas include applying business techniques like Key Performance Indicators to fix the economy, using information technology to cut government bureaucracy, and increasing the number of foreign firms with a head office in Japan. Readers gain rare insight into Japan's future, from both academic and practical perspectives on the inside. Mikitani argues that Japan's tendency to shun international frameworks and hide from global realities is the root of the problem, while Mikitani Sr.'s background as an international economist puts the issue in perspective for a well-rounded look at today's Japan. Examine the causes of Japan's endless economic stagnation Discover the current efforts underway to enhance Japan's competitiveness Learn how free market "Abenomics" affected Japan's economy long-term See Japan's issues from the perspective of an entrepreneur and an economist Japan's malaise is seated in a number of economic, business, political, and cultural issues, and this book doesn't shy away from hot topics. More than a discussion of economics, this book is a conversation between father and son as they work through opposing perspectives to help their country find The Power to Compete.

The Origin and Nature of Life on Earth

The Origin and Nature of Life on Earth Author Eric Smith
ISBN-10 9781107121881
Year 2016-04-30
Pages 840
Language en
Publisher Cambridge University Press
DOWNLOAD NOW READ ONLINE

Uniting the foundations of physics and biology, this groundbreaking multidisciplinary and integrative book explores life as a planetary process.

Creation

Creation Author Adam Rutherford
ISBN-10 9780141970226
Year 2013-04-04
Pages 272
Language en
Publisher Penguin UK
DOWNLOAD NOW READ ONLINE

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Life s Greatest Secret

Life s Greatest Secret Author Matthew Cobb
ISBN-10 9781782830023
Year 2015-06-11
Pages 728
Language en
Publisher Profile Books
DOWNLOAD NOW READ ONLINE

Life's Greatest Secret is the story of the discovery and cracking of the genetic code. This great scientific breakthrough has had far-reaching consequences for how we understand ourselves and our place in the natural world. The code forms the most striking proof of Darwin's hypothesis that all organisms are related, holds tremendous promise for improving human well-being, and has transformed the way we think about life. Matthew Cobb interweaves science, biography and anecdote in a book that mixes remarkable insights, theoretical dead-ends and ingenious experiments with the pace of a thriller. He describes cooperation and competition among some of the twentieth century's most outstanding and eccentric minds, moves between biology, physics and chemistry, and shows the part played by computing and cybernetics. The story spans the globe, from Cambridge MA to Cambridge UK, New York to Paris, London to Moscow. It is both thrilling science and a fascinating story about how science is done.

Life s Ratchet

Life s Ratchet Author Peter M. Hoffmann
ISBN-10 9780465022533
Year 2012
Pages 278
Language en
Publisher Basic Books
DOWNLOAD NOW READ ONLINE

A physicist describes how life emerges from the random motion of atoms through sophisticated cellular machinery and describes the long quest to determine the true nature of life from ancient Greece to the study of modern nanotechnology. 20,000 first printing.